Top » Catalog » R1b » A326

$18.00

A326
[A326]

A326
hg38 Position: ChrY:19880063..19880063
Ancestral: G
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A326_F TCCCAAAAATGGAAGAATGG
Reverse Primer: A326_R GGTGGATCAGTGTCACTGGTC
Reviews

Customers who bought this product also purchased
A321
A321
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies