Top » Catalog » R1b » A479

$18.00

A479
[A479]

A479
hg38 Position: ChrY:20634725..20634725
Ancestral: G
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a2c1e~
Comments: Below Z255
Forward Primer: A479_F GTTGAGCTTTTTGCCCATATC
Reverse Primer: A479_R TGTCATTCAACTGAAGATGACAAG
Reviews (1)

Customers who bought this product also purchased
BY582
BY582
R1b-Z255 Panel
R1b-Z255 Panel
Z18136
Z18136
Z17694
Z17694
Z16437
Z16437
Z16433
Z16433
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies