Top » Catalog » R1b » A495

$18.00

A495
[A495]

A495
hg38 Position: ChrY:8756535..8756535
Ancestral: G
Derived: T
Reference: Dennis Wright (2014)
ISOGG Haplogroup: R1b1a2a1a2c1f (not listed)
Comments: Z253
Forward Primer: A495v2_F ACAAAGGAAAGTGCATGAAGC
Reverse Primer: A495v2_R GACTTCGGGTAAACTGACTGTCT
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
FGC3249
FGC3249
L226
L226
FGC17449
FGC17449
S15280
S15280
A17
A17
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies