Top » Catalog » R1b » A495

$18.00

A495
[A495]

A495
hg38 Position: ChrY:8756535..8756535
Ancestral: G
Derived: T
Reference: Dennis Wright (2014)
ISOGG Haplogroup: R1b1a2a1a2c1f (not listed)
Comments: Z253
Forward Primer: A495v2_F ACAAAGGAAAGTGCATGAAGC
Reverse Primer: A495v2_R GACTTCGGGTAAACTGACTGTCT
Reviews

Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A634
1 x A2080
1 x A889
1 x A424
1 x A125
1 x A719
1 x A2076
1 x A793
1 x A997
1 x A348
1 x A758
1 x A2207
$216.00
Haplogroup Info
Other products
Currencies