Top » Catalog » R1b » A496

$18.00

A496
[A496]

A496
hg38 Position: ChrY:8965916..8965916
Ancestral: G
Derived: T
Reference: Dennis Wright (2014)
ISOGG Haplogroup: R1b1a2a1a2c1f (not listed)
Comments: Z253
Forward Primer: A496_F ATTGGAATGCTTTTAAACTCCCA
Reverse Primer: A496_R CTCTCTGTTTTCCTGTTTCACTCTC
Reviews

Customers who bought this product also purchased
S7897
S7897
S7898
S7898
A494
A494
A500
A500
A495
A495
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A498
$18.00
Haplogroup Info
Other products
Currencies