Top » Catalog » R1b » A498

$18.00

A498
[A498]

A498
hg38 Position: ChrY:10068400..10068400
Ancestral: G
Derived: T
Reference: Dennis Wright (2014)
ISOGG Haplogroup: R1b1a2a1a2c1f (not listed)
Comments: Z253
Forward Primer: A498_F AATGGAAGGAAAAGTTAGAAGCAAG
Reverse Primer: A498_R GGACAAATGTGGCTGTAGTAAACTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2142
1 x A1314
1 x A164
1 x A1308
1 x A985
1 x A759
1 x A350
1 x A1742
1 x A251
1 x A911
1 x A642
1 x A1539
1 x A1011
1 x A426
1 x A525
1 x A809
1 x A1072
1 x A1142
1 x A571
1 x A1079
1 x A1774
1 x A1274
1 x A726
1 x A932
1 x A795
$450.00
Haplogroup Info
Other products
Currencies