Top » Catalog » R1b » A500

$19.00

A500
[A500]

A500
hg38 Position: ChrY:14794795..14794795
Ancestral: C
Derived: T
Reference: Dennis Wright (2014)
ISOGG Haplogroup: R1b1a2a1a2c1f (not listed)
Comments: Z253
Forward Primer: A500_F CCATGAAAATTCTTGGAGCTG
Reverse Primer: A500_R AGCCAGGGCAACAGAGTAAG
Reviews

Customers who bought this product also purchased
A494
A494
A496
A496
A495
A495
S7897
S7897
S7898
S7898
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies