Top » Catalog » R1b » A501

$18.00

A501
[A501]

A501
hg38 Position: ChrY:15670392..15670392
Ancestral: G
Derived: T
Reference: Dennis Wright (2014)
ISOGG Haplogroup: R1b1a2a1a2c1f (not listed)
Comments: Z253
Forward Primer: A501_F TGAGATCTCCAAGCATTCCAC
Reverse Primer: A501_R GGATTGTTTTTAAAATGGGGTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies