Top » Catalog » R1b » A504

$18.00

A504
[A504]

A504
hg38 Position: ChrY:17211820..17211820
Ancestral: C
Derived: T
Reference: Dennis Wright (2014)
ISOGG Haplogroup: R1b1a2a1a2c1f (not listed)
Comments: Z253
Forward Primer: A504_F GAAAAATAGGATTCACCAAATGAGC
Reverse Primer: A504_R AAGAAGAGTCACCCACAGCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies