Top » Catalog » R1b » A505

$19.00

A505
[A505]

A505
hg38 Position: ChrY:17355406..17355406
Ancestral: T
Derived: C
Reference: Dennis Wright (2014)
ISOGG Haplogroup: R1b1a2a1a2c1f (not listed)
Comments: Z253
Forward Primer: A505_F TGGGGTTAGTTTCCCACAAG
Reverse Primer: A505_R TTTCTCATTACTGGAGGCTTTTC
Reviews
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies