Top » Catalog » R1b » A506

$18.00

A506
[A506]

A506
hg38 Position: ChrY:19698620..19698620
Ancestral: T
Derived: C
Reference: Dennis Wright (2014)
ISOGG Haplogroup: R1b1a2a1a2c1f (not listed)
Comments: Z253
Forward Primer: A506_F TTGCTCATTTTTGCATTTGG
Reverse Primer: A506_R TATTGGGAGGTGGTGAGGTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2270
$18.00
Haplogroup Info
Other products
Currencies