Top » Catalog » R1b » A277

$18.00

A277
[A277]

A277
hg38 Position: ChrY:9264166..9264166
Ancestral: A
Derived: G
Reference: Dennis Wright (2014)
ISOGG Haplogroup: R1b1a2a1a2c1f2
Comments: Downstream Z2534/S868 and upstream L643
Forward Primer: A277_F GCAGTCCCACTCAGGAAGAGT
Reverse Primer: A277_R CTAGGGTTTCCTGGGTCTCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies