Top » Catalog » R1b » A508

$18.00

A508
[A508]

A508
hg38 Position: ChrY:17135301..17135301
Ancestral: C
Derived: T
Reference: Bruce Cockburn (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A508_F TTGTGCCCTTCCCAATTTAG
Reverse Primer: A508_R TGGATTTTGAGAACAGAGCAG
Reviews

Customers who bought this product also purchased
A24297
A24297
A24296
A24296
A24295
A24295
DYS570
DYS570
DYS390
DYS390
DYS607
DYS607
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies