Top » Catalog » R1b » A510

$18.00

A510
[A510]

A510
hg38 Position: ChrY:12165478..12165478
Ancestral: A
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below L257
Forward Primer: A510_F GAGACCCCCATTCCTACCC
Reverse Primer: A510_R AGTCTGTTGTCCAGCCTGGA
Reviews

Customers who bought this product also purchased
A604
A604
A603
A603
A511
A511
A514
A514
A513
A513
A512
A512
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1721
1 x A310
1 x A1302
1 x A684
$72.00
Haplogroup Info
Other products
Currencies