Top » Catalog » R1b » A511

$18.00

A511
[A511]

A511
hg38 Position: ChrY:13281072..13281072
Ancestral: C
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a1b1a1
Comments: Downstream L257 > Z8190 > Z375 > Z8191 > S5739 > S5443 > A512 Aka ZP62
Forward Primer: A511_F CGTTTGTCAGCAGACTTCCTG
Reverse Primer: A511_R TTCTTTCCTTGCTGTCTCCCT
Reviews

Customers who bought this product also purchased
S5443
S5443
YSEQ-XTD
YSEQ-XTD
S5750
S5750
A604
A604
A603
A603
A512
A512
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1049
$18.00
Haplogroup Info
Other products
Currencies