Top » Catalog » R1b » A512

$18.00

A512
[A512]

A512
hg38 Position: ChrY:15307469..15307469
Ancestral: C
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a1b1a1
Comments: Downstream S5443
Forward Primer: A512_F GTGGGGGAATCTATTCCCTG
Reverse Primer: A512_R TCTATTCCTAAATATCTACATCTTAATTCCC
Reviews

Customers who bought this product also purchased
DYF399X
DYF399X
DYS464X
DYS464X
S5443
S5443
YSEQ-XTD
YSEQ-XTD
S5750
S5750
A521
A521
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies