Top » Catalog » R1b » A513

$18.00

A513
[A513]

A513
hg38 Position: ChrY:17221196..17221196
Ancestral: T
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A513_F TGGGTTAGGGACATTTTCTGTG
Reverse Primer: A513_R CTATGAAAATTAGATCCAATTACAGAGC
Reviews

Customers who bought this product also purchased
S5750
S5750
S5443
S5443
YSEQ-XTD
YSEQ-XTD
A604
A604
A603
A603
A512
A512
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A751
$18.00
Haplogroup Info
Other products
Currencies