Top » Catalog » R1b » A513

$18.00

A513
[A513]

A513
hg38 Position: ChrY:17221196..17221196
Ancestral: T
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A513_F TGGGTTAGGGACATTTTCTGTG
Reverse Primer: A513_R CTATGAAAATTAGATCCAATTACAGAGC
Reviews

Customers who bought this product also purchased
YSEQ-XTD
YSEQ-XTD
S5750
S5750
S5443
S5443
A604
A604
A603
A603
A514
A514
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A342
1 x A1080
1 x A694
1 x A2170
1 x A7
1 x A1766
1 x A1141
1 x A570
1 x A2071
1 x A683
1 x A2146
$198.00
Haplogroup Info
Other products
Currencies