Top » Catalog » R1b » A517

$18.00

A517
[A517]

A517
hg38 Position: ChrY:14403166..14403166
Ancestral: A
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Approx. R1b-U152
Forward Primer: A517_F ACAAGTTGAAGAGTACAGCACACAC
Reverse Primer: A517_R TCTCAAGACAACGCAGATGTATG
Reviews

Customers who bought this product also purchased
P312
P312
PF6645
PF6645
FGC6418
FGC6418
R1b-M343 Orientation Panel
R1b-M343 Orientation Panel
Y17161
Y17161
Z36
Z36
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2076
$18.00
Haplogroup Info
Other products
Currencies