Top » Catalog » R1b » A517

$18.00

A517
[A517]

A517
hg38 Position: ChrY:14403166..14403166
Ancestral: A
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Approx. R1b-U152
Forward Primer: A517_F ACAAGTTGAAGAGTACAGCACACAC
Reverse Primer: A517_R TCTCAAGACAACGCAGATGTATG
Reviews

Customers who bought this product also purchased
Y38089
Y38089
BY33010
BY33010
FGC30121
FGC30121
DF19
DF19
A12510
A12510
M343
M343
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies