Top » Catalog » R1b » A517

$18.00

A517
[A517]

A517
hg38 Position: ChrY:14403166..14403166
Ancestral: A
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Approx. R1b-U152
Forward Primer: A517_F ACAAGTTGAAGAGTACAGCACACAC
Reverse Primer: A517_R TCTCAAGACAACGCAGATGTATG
Reviews

Customers who bought this product also purchased
Z36
Z36
L145
L145
DF19
DF19
A12510
A12510
M343
M343
U152
U152
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1251
1 x A167
1 x A151
1 x A308
$72.00
Haplogroup Info
Other products
Currencies