Top » Catalog » R1b » A517

$18.00

A517
[A517]

A517
hg38 Position: ChrY:14403166..14403166
Ancestral: A
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Approx. R1b-U152
Forward Primer: A517_F ACAAGTTGAAGAGTACAGCACACAC
Reverse Primer: A517_R TCTCAAGACAACGCAGATGTATG
Reviews

Customers who bought this product also purchased
Z2103
Z2103
PF7563
PF7563
BY177884
BY177884
Y140068
Y140068
BY3851
BY3851
SK2076
SK2076
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies