Top » Catalog » R1b » A518

$18.00

A518
[A518]

A518
hg38 Position: ChrY:20897386..20897386
Ancestral: C
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Approx. R1b-U152
Forward Primer: A518_F GAGACACATTTTACCCATGGATG
Reverse Primer: A518_R TTTCTGGCCATTTGCAGTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A447
1 x A250
1 x A441
1 x A671
1 x A579
1 x A1169
1 x A760
1 x A747
1 x A1491
$162.00
Haplogroup Info
Other products
Currencies