Top » Catalog » R1b » A520

$18.00

A520
[A520]

A520
hg38 Position: ChrY:14733202..14733202
Ancestral: A
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Approx. R1b-U152
Forward Primer: A520_F GGGAAACAGGGTGAGGAGTG
Reverse Primer: A520_R GAAAAATGAAAATAAAACTTGTCTTCATAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies