Top » Catalog » R1b » A521

$18.00

A521
[A521]

A521
hg38 Position: ChrY:7352775..7352775
Ancestral: G
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A521_F CAGGTACCACTATCTTCCAGGC
Reverse Primer: A521_R AAACTCTTGGGCTTGTGCAG
Reviews

Customers who bought this product also purchased
A512
A512
A526
A526
A525
A525
A524
A524
A530
A530
A529
A529
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1721
1 x A1036
1 x A1163
1 x A2155
1 x A113
1 x A1758
1 x A818
1 x A531
1 x A2220
1 x A2139
1 x A35
1 x A749
1 x A1369
1 x A773
1 x A1177
1 x A748
1 x A1303
1 x A1289
$324.00
Haplogroup Info
Other products
Currencies