Top » Catalog » R1b » A524

$18.00

A524
[A524]

A524
hg38 Position: ChrY:12386197..12386197
Ancestral: T
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A524_F CCATGCCCTCTTCTTATTGC
Reverse Primer: A524_R AATTATCTATCTATGCTGTGTCTCCC
Reviews

Customers who bought this product also purchased
A512
A512
A526
A526
A525
A525
A521
A521
A530
A530
A529
A529
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies