Top » Catalog » R1b » A525

$18.00

A525
[A525]

A525
hg38 Position: ChrY:13124563..13124563
Ancestral: C
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A525_F GACAGGGTTTCACTGCATTTG
Reverse Primer: A525_R TGGATTTAAACTGAGCTTTACTTAACC
Reviews

Customers who bought this product also purchased
A512
A512
A521
A521
A530
A530
A529
A529
A526
A526
A524
A524
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A225
1 x A902
1 x A1259
1 x A1537
1 x A419
1 x A2219
1 x A603
1 x A777
1 x A206
1 x A625
1 x A2253
1 x A1160
1 x A317
1 x A803
1 x A2208
1 x A166
1 x A988
1 x A797
$324.00
Haplogroup Info
Other products
Currencies