Top » Catalog » R1b » A529

$18.00

A529
[A529]

A529
hg38 Position: ChrY:21245806..21245806
Ancestral: C
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A529_F GAAGGCAATCCACCTGAGTG
Reverse Primer: A529_R CAGATAAGTTTGGACCACTCCTC
Reviews

Customers who bought this product also purchased
A512
A512
A525
A525
A524
A524
A521
A521
A530
A530
A526
A526
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies