Top » Catalog » R1b » A530

$18.00

A530
[A530]

A530
hg38 Position: ChrY:14759306..14759307
Ancestral: del
Derived: ins
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A530_F CCATAGCTCATGCAAATCGTG
Reverse Primer: A530_R TTTTTGGCTGTGCACGGC
Reviews

Customers who bought this product also purchased
A512
A512
A524
A524
A521
A521
A529
A529
A526
A526
A525
A525
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A642
$18.00
Haplogroup Info
Other products
Currencies