Top » Catalog » R1b » A353

$18.00

A353
[A353]

A353
hg38 Position: ChrY:17104693..17104694
Ancestral: del
Derived: ins
Reference: Ron McRaney (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Approx. R1b-CTS4466
Forward Primer: A353_F CCAGCACTTTTTGAGGTTGG
Reverse Primer: A353_R CCCACAATCCTCATGTGTCC
Reviews

Customers who bought this product also purchased
BY23383
BY23383
FGC11304
FGC11304
FGC11272
FGC11272
A12386
A12386
BY11096
BY11096
FGC54816
FGC54816
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2194
1 x A887
1 x A987
1 x A2201
1 x A458
1 x A189
1 x A1729
1 x A560
1 x A2070
$162.00
Haplogroup Info
Other products
Currencies