Top » Catalog » R1b » A531

$18.00

A531
[A531]

A531
hg38 Position: ChrY:14298207..14298207
Ancestral: C
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Approx. L1. S1791
Forward Primer: A531_F ATCAAACAGCTTGAACTTGTGG
Reverse Primer: A531_R GGGAGCTAGGGGAGAGATAGC
Reviews

Customers who bought this product also purchased
A410
A410
A415
A415
A412
A412
A411
A411
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2226
1 x A2267
1 x A1056
1 x A746
1 x A792
1 x A1507
1 x A1309
1 x A986
1 x A1302
1 x A450
1 x A715
1 x A2265
1 x A1540
$234.00
Haplogroup Info
Other products
Currencies