Top » Catalog » R1b » A532

$18.00

A532
[A532]

A532
hg38 Position: ChrY:19242842..19242842
Ancestral: G
Derived: C
Reference: John B. Sullivan (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1f2c3
Comments: Below Z2185
Forward Primer: A532_F TCTGACTTGTGTGGCAACTAGC
Reverse Primer: A532_R GATCTGATGGTCGGGCTTAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A426
1 x A720
$36.00
Haplogroup Info
Other products
Currencies