Top » Catalog » R1b » A220

$18.00

A220
[A220]

A220
hg38 Position: ChrY:22454319..22454319
Ancestral: T
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Found in a R1b-CTS4466 person. In the middle of a palindromic STR
Forward Primer: A220_F GTGTGACTGTAAGTGCAGTCTGC
Reverse Primer: A220_R AGGCGGATGTTATTTGGATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A592
1 x A1174
1 x A33
1 x A2132
1 x A1171
1 x A171
1 x A1292
1 x A1339
1 x A2121
1 x A2123
1 x A2151
1 x A2197
1 x A1782
$234.00
Haplogroup Info
Other products
Currencies