Top » Catalog » R1b » A534

$18.00

A534
[A534]

A534
hg38 Position: ChrY:7187106..7187106
Ancestral: A
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a1c2b1b (not listed)
Comments: Approx. Z159. Z160
Forward Primer: A534_F GATCCAATCACCTCCTGCC
Reverse Primer: A534_R GCTCTTCGTCTCTGAGTGGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A799
1 x A593
$36.00
Haplogroup Info
Other products
Currencies