Top » Catalog » R1b » A537

$18.00

A537
[A537]

A537
hg38 Position: ChrY:12716961..12716961
Ancestral: T
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a1c2b1b (not listed)
Comments: Approx. Z159. Z160
Forward Primer: A537_F CCGGCCTCTTCTGCTATTG
Reverse Primer: A537_R AGGGTTCAGGATGAAACCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1237
1 x A1781
1 x A2138
1 x A2247
1 x A1192
1 x A365
1 x A699
1 x A646
1 x A955
1 x A2134
1 x A674
1 x A2122
$216.00
Haplogroup Info
Other products
Currencies