Top » Catalog » R1b » A850

$18.00

A850
[A850]

A850
hg38 Position: ChrY:8834300..8834300
Ancestral: G
Derived: A
Reference: Les Tate (2014)
ISOGG Haplogroup: R1b1a2a1a2c1k1a2 (not listed)
Comments: Downstream of S691
Forward Primer: A850_F ACAGGAAAGGGACCTGGG
Reverse Primer: A850_R ACAAGTGAAGTTGAAGGCATAGTG
Reviews

Customers who bought this product also purchased
L1335
L1335
A9864
A9864
FGC9572
FGC9572
FGC19633
FGC19633
A5291
A5291
A6932
A6932
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies