Top » Catalog » R1b » A564

$18.00

A564
[A564]

A564
hg38 Position: ChrY:12466157..12466157
Ancestral: C
Derived: T
Reference: Andrew Booth (2014)
ISOGG Haplogroup: R1b1a1a2a1a1a2b
Comments: Aka Z11575. Below U106 > FGC3861 > FGC14877
Forward Primer: A564_F CAGACTCTGAAGATGCCCTTC
Reverse Primer: A564_R ACAGACTTGGGAAATGCCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A162
$18.00
Haplogroup Info
Other products
Currencies