Top » Catalog » R1b » A307

$18.00

A307
[A307]

A307
hg38 Position: ChrY:21852585..21852585
Ancestral: G
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A307_F GGCTTACAACTCCAAACGGC
Reverse Primer: A307_R TGTACTCCTTCAAATAATGAGAAGCC
Reviews

Customers who bought this product also purchased
A309
A309
A308
A308
A306
A306
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A306
1 x A1773
1 x A187
1 x A551
1 x A95
1 x A1322
1 x A410
1 x A975
1 x A135
1 x A359
1 x A510
1 x A337
1 x A629
1 x A467
1 x A1165
1 x A1161
1 x A462
1 x A1495
1 x A927
1 x A1269
1 x A1234
1 x A2141
1 x A972
$414.00
Haplogroup Info
Other products
Currencies