Top » Catalog » R1b » A308

$18.00

A308
[A308]

A308
hg38 Position: ChrY:9270763..9270763
Ancestral: A
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A308_F AATGAGGCAGGTTTTAGCGC
Reverse Primer: A308_R CCAGAGAGCCTATGCGATG
Reviews

Customers who bought this product also purchased
A309
A309
A307
A307
A306
A306
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies