Top » Catalog » R1b » A545

$18.00

A545
[A545]

A545
hg38 Position: ChrY:7323355..7323355
Ancestral: T
Derived: C
Reference: AP (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream A241
Forward Primer: A545_F TTCCCAGTAGGTTTGGGATG
Reverse Primer: A545_R TGGAGACAGGGCATGTAAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies