Top » Catalog » R1b » A546

$18.00

A546
[A546]

A546
hg38 Position: ChrY:8597456..8597456
Ancestral: C
Derived: G
Reference: AP (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream A241
Forward Primer: A546_F TGTTTGAATGTTGCCTGGAC
Reverse Primer: A546_R TTCACGAAAGAGGCTGTGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A663
1 x A418
1 x A1010
1 x A791
1 x A558
1 x A1231
1 x A2160
1 x A714
1 x A958
1 x A604
$180.00
Haplogroup Info
Other products
Currencies