Top » Catalog » R1b » A547

$18.00

A547
[A547]

A547
hg38 Position: ChrY:8929045..8929045
Ancestral: C
Derived: T
Reference: AP (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream A241
Forward Primer: A547_F TTCTAGAAGTATGTAGACCTAGGCGTG
Reverse Primer: A547_R AATCCCCTGCAGCACTACTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies