Top » Catalog » R1b » A548

$18.00

A548
[A548]

A548
hg38 Position: ChrY:9542862..9542862
Ancestral: G
Derived: A
Reference: AP (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream A241
Forward Primer: A548_F CAGGAAGTGCCATTATGCG
Reverse Primer: A548_R GAAGCTGAACGCAGTTGTGT
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A907
1 x A62
1 x A71
1 x A214
1 x A119
$90.00
Haplogroup Info
Other products
Currencies