Top » Catalog » R1b » A550

$18.00

A550
[A550]

A550
hg38 Position: ChrY:14382479..14382479
Ancestral: A
Derived: G
Reference: AP (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream A241. Dinucleotide repeat region!
Forward Primer: A550_F AAGGGCAAGTGAAAACCTACC
Reverse Primer: A550_R TGTCAATTTTAGTGGAGTCTCATAGC
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies