Top » Catalog » R1b » A551

$18.00

A551
[A551]

A551
hg38 Position: ChrY:14548877..14548877
Ancestral: G
Derived: T
Reference: AP (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream A241
Forward Primer: A551_F TCTCCATAGGCCCTGACTTG
Reverse Primer: A551_R GCTTGGGAAGATGACGAGAC
Reviews

Customers who bought this product also purchased
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
A241
A241
L513
L513
Z251
Z251
S11556
S11556
DF21
DF21
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies