Top » Catalog » R1b » A551

$18.00

A551
[A551]

A551
hg38 Position: ChrY:14548877..14548877
Ancestral: G
Derived: T
Reference: AP (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream A241
Forward Primer: A551_F TCTCCATAGGCCCTGACTTG
Reverse Primer: A551_R GCTTGGGAAGATGACGAGAC
Reviews

Customers who bought this product also purchased
Z16943
Z16943
Z253
Z253
A237
A237
Z255
Z255
FGC13899
FGC13899
DF49
DF49
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies