Top » Catalog » R1b » A552

$18.00

A552
[A552]

A552
hg38 Position: ChrY:19027985..19027985
Ancestral: C
Derived: T
Reference: AP (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream A241
Forward Primer: A552_F CCATTAGTGAGCATTTAGTGGTGAC
Reverse Primer: A552_R TTGGTTAAGGACTAACAGAGGACAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A514
1 x A1185
1 x A30
1 x A1333
1 x A98
1 x A138
1 x A1175
1 x A1783
1 x A991
1 x A1492
1 x A2152
1 x A474
1 x A804
1 x A388
$252.00
Haplogroup Info
Other products
Currencies