Top » Catalog » R1b » A549

$18.00

A549
[A549]

A549
hg38 Position: ChrY:12404845..12404845
Ancestral: C
Derived: T
Reference: AP (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream A241
Forward Primer: A549_F TCAATCCAAATATAAACACAATCAAATG
Reverse Primer: A549_R GTTCGAGGCTGTAGTGAGCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A880
$18.00
Haplogroup Info
Other products
Currencies