Top » Catalog » R1b » A10023

$16.00

A10023
[A10023]

A10023
HG19 Position: ChrY:7512936..7512936
Ancestral: T
Derived: G
Reference: Randy Zielaskowski (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below Z326 > A5011
Forward Primer: A10023_F TTCATTAGCTTGGCAACAATTAAC
Reverse Primer: A10023_R GATAACTTTTATTGGTGACAGGAAGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies