Top » Catalog » R1b » A10106

$18.00

A10106
[A10106]

A10106
HG19 Position: ChrY:19397712..19397712
Ancestral: C
Derived: T
Reference: Douglas Fisher (2016)
ISOGG Haplogroup: R1b
Comments: Below Z18 > Z372 > S5970
Forward Primer: A10106_F GAGAACATTGTAAAGAGCCTGACAC
Reverse Primer: A10106_R AGTCTGCATGGTGTCACATTTC
Reviews

Customers who bought this product also purchased
A10107
A10107
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies