Top » Catalog » R1b » A10107

$18.00

A10107
[A10107]

A10107
HG19 Position: ChrY:17166777..17166777
Ancestral: A
Derived: T
Reference: Douglas Fisher (2016)
ISOGG Haplogroup: R1b
Comments: Below Z18 > Z372 > S5970
Forward Primer: A10107_F GTGCAGTTTTGTTGCATGG
Reverse Primer: A10107_R TCTTCACAGCAGCGAAGATG
Reviews

Customers who bought this product also purchased
A10106
A10106
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies